-
PurposeLaboratory adapted, genomically recoded E. coli strain without TCG, TCA, or TAG codons and deleted serT, serU, prfA, and recA genes. Evolved for ~270 generations in LB at 37 °C.
-
Depositing Lab
-
Sequence Information
-
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Bacterial Strain | 189857 | Bacteria in agar stab | 1 | $89 | |
Backbone
-
Vector backboneN.A.
Growth in Bacteria
-
Bacterial Resistance(s)Streptomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Syn61Δ3(ev5) ΔrecA (ev1)
-
Growth instructionsGrow in LB, SOB, or 2×YT at 37°C
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameΔrecA
-
SpeciesSynthetic
-
MutationΔrecA
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer GAGTTTACGTCGCAGTTCTTG
- 3′ sequencing primer ACTGAAAGCGGCTCGTGCT
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe strain is a ΔrecA, evolved derivative of Syn61Δ3(ev5) (Addgene #174514).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Details of construction, use, and characterization are available in
Nyerges A, Vinke S, Flynn R, Owen SV, Rand EA, Budnik B, Keen E, Narasimhan K, Marchand JA, Baas-Thomas M, Liu M, Chen K, Chiappino-Pepe A, Hu F, Baym M, Church GM (2022) Swapped genetic code blocks viral infections and gene transfer, https://doi.org/10.1101/2022.07.08.499367
https://www.biorxiv.org/content/10.1101/2022.07.08.499367v1.full
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Syn61Δ3(ev5) ΔrecA (ev1) was a gift from George Church (Addgene plasmid # 189857) -
For your References section:
A swapped genetic code prevents viral infections and gene transfer. Nyerges A, Vinke S, Flynn R, Owen SV, Rand EA, Budnik B, Keen E, Narasimhan K, Marchand JA, Baas-Thomas M, Liu M, Chen K, Chiappino-Pepe A, Hu F, Baym M, Church GM. Nature. 2023 Mar;615(7953):720-727. doi: 10.1038/s41586-023-05824-z. Epub 2023 Mar 15. 10.1038/s41586-023-05824-z PubMed 36922599