-
PurposeMammalian expression of calcium sensor with ultra-high dynamics and sensitivity
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 189933 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepcDNA3.1(+)
- Backbone size w/o insert (bp) 5222
- Total vector size (bp) 6482
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNEMOc
-
SpeciesSynthetic
-
Insert Size (bp)1260
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer taatacgactcactataggg
- 3′ sequencing primer TAGAAGGCACAGTCGAGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2022.08.23.504677 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCDNA3.1(+)-NEMOc was a gift from Yubin Zhou (Addgene plasmid # 189933 ; http://n2t.net/addgene:189933 ; RRID:Addgene_189933) -
For your References section:
Engineering of NEMO as calcium indicators with large dynamics and high sensitivity. Li J, Shang Z, Chen JH, Gu W, Yao L, Yang X, Sun X, Wang L, Wang T, Liu S, Li J, Hou T, Xing D, Gill DL, Li J, Wang SQ, Hou L, Zhou Y, Tang AH, Zhang X, Wang Y. Nat Methods. 2023 Jun;20(6):918-924. doi: 10.1038/s41592-023-01852-9. 10.1038/s41592-023-01852-9 PubMed 37081094