Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

synIRES_RC25
(Plasmid #189970)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 189970 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pRC
  • Backbone size w/o insert (bp) 1882
  • Total vector size (bp) 2556
  • Vector type
    Cloning

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    synIRES_RC25
  • Insert Size (bp)
    674
  • Promoter N/A

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBI (from pRC0940) (destroyed during cloning)
  • 3′ cloning site BsmBI (from pRC0940) (destroyed during cloning)
  • 5′ sequencing primer ggccttttgctggccttttgc
  • 3′ sequencing primer GATAATCGCGGCCGCGGTC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    synIRES_RC25 was a gift from Howard Chang (Addgene plasmid # 189970 ; http://n2t.net/addgene:189970 ; RRID:Addgene_189970)
  • For your References section:

    Engineering circular RNA for enhanced protein production. Chen R, Wang SK, Belk JA, Amaya L, Li Z, Cardenas A, Abe BT, Chen CK, Wender PA, Chang HY. Nat Biotechnol. 2022 Jul 18. pii: 10.1038/s41587-022-01393-0. doi: 10.1038/s41587-022-01393-0. 10.1038/s41587-022-01393-0 PubMed 35851375