Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pRC0569 (parts entry vector)
(Plasmid #189966)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 189966 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pRC
  • Backbone size w/o insert (bp) 1874
  • Total vector size (bp) 2806
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mNeonGreen
  • Species
    Synthetic
  • Insert Size (bp)
    932
  • Promoter BBa-J23100

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CCCTGATTCTGTGGATAACCGT
  • 3′ sequencing primer gattaagcattggtaactgtcagaccaa
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRC0569 (parts entry vector) was a gift from Howard Chang (Addgene plasmid # 189966 ; http://n2t.net/addgene:189966 ; RRID:Addgene_189966)
  • For your References section:

    Engineering circular RNA for enhanced protein production. Chen R, Wang SK, Belk JA, Amaya L, Li Z, Cardenas A, Abe BT, Chen CK, Wender PA, Chang HY. Nat Biotechnol. 2022 Jul 18. pii: 10.1038/s41587-022-01393-0. doi: 10.1038/s41587-022-01393-0. 10.1038/s41587-022-01393-0 PubMed 35851375