mRNA-CleanCap entry vector
(Plasmid
#188249)
-
PurposeCloning vector for generating template plasmids to transcribe mRNA, with mNeonGreen dropout following BsaI digestion
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 188249 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepRC
- Backbone size w/o insert (bp) 5236
- Total vector size (bp) 6172
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namemNeonGreen
-
SpeciesSynthetic; Branchiostoma lanceolatum
-
Insert Size (bp)936
- Promoter T7
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GGCCAGTGAATTGTAATACGACTCACTATAAG
- 3′ sequencing primer GGAAGGTGCCACTCCCACTG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Addgene Notes
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
mRNA-CleanCap entry vector was a gift from Howard Chang (Addgene plasmid # 188249 ; http://n2t.net/addgene:188249 ; RRID:Addgene_188249) -
For your References section:
Engineering circular RNA for enhanced protein production. Chen R, Wang SK, Belk JA, Amaya L, Li Z, Cardenas A, Abe BT, Chen CK, Wender PA, Chang HY. Nat Biotechnol. 2022 Jul 18. pii: 10.1038/s41587-022-01393-0. doi: 10.1038/s41587-022-01393-0. 10.1038/s41587-022-01393-0 PubMed 35851375