pHR_PGK_LaG17-mCherry-HOTag3
(Plasmid
#190024)
-
PurposeTransiently expresses GFP-binding CluMPS (LaG17-mCh-HOTag3) in mammalian cells and lentiviral vector for constitutive expression.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 190024 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepHR PGK
- Backbone size w/o insert (bp) 8912
- Total vector size (bp) 10214
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameLaG17 CluMPS
-
Alt nameLaG17-mCh-HOTag3
-
SpeciesSynthetic
-
Insert Size (bp)1302
- Promoter PGK
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer gcttcaaaagcgcacgtct
- 3′ sequencing primer caatctttcacaaattttgtaatccagagg
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2022.07.13.499962v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHR_PGK_LaG17-mCherry-HOTag3 was a gift from Lukasz Bugaj (Addgene plasmid # 190024 ; http://n2t.net/addgene:190024 ; RRID:Addgene_190024) -
For your References section:
Simple visualization of submicroscopic protein clusters with a phase-separation-based fluorescent reporter. Mumford TR, Rae D, Brackhahn E, Idris A, Gonzalez-Martinez D, Pal AA, Chung MC, Guan J, Rhoades E, Bugaj LJ. Cell Syst. 2024 Feb 21;15(2):166-179.e7. doi: 10.1016/j.cels.2024.01.005. Epub 2024 Feb 8. 10.1016/j.cels.2024.01.005 PubMed 38335954