Skip to main content

pCMV Gab1(PRD)-mCherry-HOTag3
(Plasmid #190026)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 190026 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 190026-D50 50 μg of DNA in Tris buffer $495
DNA 190026-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pCMV
  • Backbone size w/o insert (bp) 3948
  • Total vector size (bp) 5448
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Gab1(PRD) CluMPS
  • Alt name
    Gab1_proline_rich_domain-mCh-HOTag3
  • Insert Size (bp)
    1500
  • Promoter CMV

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer tgctattgctttatttgtaaccattataagc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCMV Gab1(PRD)-mCherry-HOTag3 was a gift from Lukasz Bugaj (Addgene plasmid # 190026 ; http://n2t.net/addgene:190026 ; RRID:Addgene_190026)
  • For your References section:

    Simple visualization of submicroscopic protein clusters with a phase-separation-based fluorescent reporter. Mumford TR, Rae D, Brackhahn E, Idris A, Gonzalez-Martinez D, Pal AA, Chung MC, Guan J, Rhoades E, Bugaj LJ. Cell Syst. 2024 Feb 21;15(2):166-179.e7. doi: 10.1016/j.cels.2024.01.005. Epub 2024 Feb 8. 10.1016/j.cels.2024.01.005 PubMed 38335954