pCMV Gab1(PRD)-mCherry-HOTag3
(Plasmid
#190026)
-
PurposeTransiently expresses CluMPS for reporting on EML4-ALK oncogene clusters in mammalian cells.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 190026 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCMV
- Backbone size w/o insert (bp) 3948
- Total vector size (bp) 5448
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameGab1(PRD) CluMPS
-
Alt nameGab1_proline_rich_domain-mCh-HOTag3
-
Insert Size (bp)1500
- Promoter CMV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer tgctattgctttatttgtaaccattataagc
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2022.07.13.499962v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV Gab1(PRD)-mCherry-HOTag3 was a gift from Lukasz Bugaj (Addgene plasmid # 190026 ; http://n2t.net/addgene:190026 ; RRID:Addgene_190026) -
For your References section:
Simple visualization of submicroscopic protein clusters with a phase-separation-based fluorescent reporter. Mumford TR, Rae D, Brackhahn E, Idris A, Gonzalez-Martinez D, Pal AA, Chung MC, Guan J, Rhoades E, Bugaj LJ. Cell Syst. 2024 Feb 21;15(2):166-179.e7. doi: 10.1016/j.cels.2024.01.005. Epub 2024 Feb 8. 10.1016/j.cels.2024.01.005 PubMed 38335954