pGTM_YR375_SUMO_Protease_001
(Plasmid
#190063)
-
PurposeExpresses the yeast Ulp1 Sumo protease in active form as a TEV protease-cleavable MBP fusion
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 190063 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 * |
* Log in to view industry pricing.
Backbone
-
Vector backbonepET15_8HMbpTEV_NESG
-
Backbone manufacturerNovagen/Northeast Structural Genomics Consortium
- Backbone size w/o insert (bp) 6868
- Total vector size (bp) 7912
-
Modifications to backboneThis vector contains an N-terminal 8X-His tag fused in frame with the Maltose Binding Protein (MBP) Solubility Enhancing Tag (SET). The passenger protein (Ulp1 residues 347 - 621) can be cleaved from the MBP tag by Tobacco Etch Virus Protease (TEV).
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameULP1_YEAST
-
Alt nameSumo Protease
-
SpeciesS. cerevisiae (budding yeast)
-
Insert Size (bp)1044
-
MutationConstruct contains residues 347 – 621
-
GenBank IDNP_015305 NP_015305
-
Entrez GeneULP1 (a.k.a. YPL020C, NIB1)
- Promoter T7 lac
-
Tag
/ Fusion Protein
- 8X His-MBP (Maltose Binding Protein) (N terminal on backbone)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer attaacggcgacggtgccgggc
- 3′ sequencing primer T7 Reverse (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGTM_YR375_SUMO_Protease_001 was a gift from Gaetano Montelione (Addgene plasmid # 190063 ; http://n2t.net/addgene:190063 ; RRID:Addgene_190063) -
For your References section:
Protocol for production and purification of SARS-CoV-2 3CL(pro). Mazzei L, Greene-Cramer R, Bafna K, Jovanovic A, De Falco A, Acton TB, Royer CA, Ciurli S, Montelione GT. STAR Protoc. 2023 May 5;4(2):102326. doi: 10.1016/j.xpro.2023.102326. 10.1016/j.xpro.2023.102326 PubMed 37235475