Skip to main content

pGTM_YR375_SUMO_Protease_001
(Plasmid #190063)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 190063 Standard format: Plasmid sent in bacteria as agar stab 1 $89 *

* Log in to view industry pricing.

Backbone

  • Vector backbone
    pET15_8HMbpTEV_NESG
  • Backbone manufacturer
    Novagen/Northeast Structural Genomics Consortium
  • Backbone size w/o insert (bp) 6868
  • Total vector size (bp) 7912
  • Modifications to backbone
    This vector contains an N-terminal 8X-His tag fused in frame with the Maltose Binding Protein (MBP) Solubility Enhancing Tag (SET). The passenger protein (Ulp1 residues 347 - 621) can be cleaved from the MBP tag by Tobacco Etch Virus Protease (TEV).
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    ULP1_YEAST
  • Alt name
    Sumo Protease
  • Species
    S. cerevisiae (budding yeast)
  • Insert Size (bp)
    1044
  • Mutation
    Construct contains residues 347 – 621
  • GenBank ID
    NP_015305 NP_015305
  • Entrez Gene
    ULP1 (a.k.a. YPL020C, NIB1)
  • Promoter T7 lac
  • Tag / Fusion Protein
    • 8X His-MBP (Maltose Binding Protein) (N terminal on backbone)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer attaacggcgacggtgccgggc
  • 3′ sequencing primer T7 Reverse
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGTM_YR375_SUMO_Protease_001 was a gift from Gaetano Montelione (Addgene plasmid # 190063 ; http://n2t.net/addgene:190063 ; RRID:Addgene_190063)
  • For your References section:

    Protocol for production and purification of SARS-CoV-2 3CL(pro). Mazzei L, Greene-Cramer R, Bafna K, Jovanovic A, De Falco A, Acton TB, Royer CA, Ciurli S, Montelione GT. STAR Protoc. 2023 May 5;4(2):102326. doi: 10.1016/j.xpro.2023.102326. 10.1016/j.xpro.2023.102326 PubMed 37235475