AAV2 for Split-PE, gRNAs + MMLV-RT(dRH)-P2A-eGFP (PKC1002)
(Plasmid
#190112)
-
PurposeAAV2 for expression of pegRNA and ngRNA (HEKs3, CTT insertion) + MMLV-RT(dRH)-P2A-eGFP
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 190112 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneAAV
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameMMLV-RT(dRH)
-
SpeciesSynthetic
-
Mutationmutations from RT in PE2 and truncation of RNAse H domain (C-terminal 181AA)
- Promoter EFS
-
Tags
/ Fusion Proteins
- bpNLS (N terminal on insert)
- bpNLS-P2A-eGFP (C terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer n/a (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameU6-pegRNA(HEKs3, CTT ins)-H1-ngRNA(HEK s3)
-
Alt namepegRNA: ggcccagactgagcacgtga, ngRNA: gtcaaccagtatcccggtgc
- Promoter U6, H1
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer n/a (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAV2 for Split-PE, gRNAs + MMLV-RT(dRH)-P2A-eGFP (PKC1002) was a gift from Keith Joung (Addgene plasmid # 190112 ; http://n2t.net/addgene:190112 ; RRID:Addgene_190112) -
For your References section:
Engineered CRISPR prime editors with compact, untethered reverse transcriptases. Grunewald J, Miller BR, Szalay RN, Cabeceiras PK, Woodilla CJ, Holtz EJB, Petri K, Joung JK. Nat Biotechnol. 2023 Mar;41(3):337-343. doi: 10.1038/s41587-022-01473-1. Epub 2022 Sep 26. 10.1038/s41587-022-01473-1 PubMed 36163548