Skip to main content

AAV_pMBP-dnVamp2-P2AT2A-EGFP-caax
(Plasmid #190153)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 190153 Standard format: Plasmid sent in bacteria as agar stab 1 $89

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    pBZ-167 AAV CMV promoter base vector
  • Backbone manufacturer
    Zuchero lab
  • Backbone size w/o insert (bp) 4561
  • Total vector size (bp) 5640
  • Modifications to backbone
    Removed CMV promoter, replaced with MBP promoter for oligodendrocyte expression (Gow...Lazzarini 1991, PMID:1383235)
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    Due to repetitive elements (AAV ITRs) we propagate using recombination-deficient bacteria, eg Stabl3 or NEB Stable. Alternatively it may be possible to use a standard bacterial strain and grow at 30C for longer, which may reduce recombination. Always fully sequence after propagation.
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Vamp2
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    282
  • Mutation
    Truncation that includes only AA #1-94
  • Entrez Gene
    Vamp2 (a.k.a. Syb-2, Syb2, Vamp-2, sybII)
  • Promoter MBP
  • Tag / Fusion Protein
    • P2AT2A-EGFP-caax (C terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer GCCTCTTTTCCCGAGATG
  • 3′ sequencing primer TATTAGGACAAGGCTGGTGGGCAC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Vamp2 was was from Prof. Stephanie Gupton MBP promoter was from Gow...Lazzarini (JCB 1991) P2AT2A was from Addgene #87828, a kind gift of the Andrea Musacchio lab

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Uribina...& Gupton; PMID: 29351997
Gow...& Lazzarini; PMID:1383235
Pan... & Musacchio; PMID: 28059702.

Please visit https://www.biorxiv.org/content/10.1101/2022.07.08.498895v1 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAV_pMBP-dnVamp2-P2AT2A-EGFP-caax was a gift from Brad Zuchero (Addgene plasmid # 190153 ; http://n2t.net/addgene:190153 ; RRID:Addgene_190153)
  • For your References section:

    CNS myelination requires VAMP2/3-mediated membrane expansion in oligodendrocytes. Lam M, Takeo K, Almeida RG, Cooper MH, Wu K, Iyer M, Kantarci H, Zuchero JB. Nat Commun. 2022 Sep 23;13(1):5583. doi: 10.1038/s41467-022-33200-4. 10.1038/s41467-022-33200-4 PubMed 36151203