pET-Duet1-6xHis-TEV-OPTN
(Plasmid
#190192)
-
PurposePlasmid for the expression of 6xHis-TEV-OPTN. Internal reference: SMC397
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 190192 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepET Duet1
-
Backbone manufacturerNovagen
- Backbone size w/o insert (bp) 5420
- Total vector size (bp) 7145
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameoptineurin
-
Alt nameNRP
-
Alt nameFIP2
-
SpeciesH. sapiens (human)
-
GenBank IDNC_000010.11
-
Entrez GeneOPTN (a.k.a. ALS12, FIP2, GLC1E, HIP7, HYPL, NRP, TFIIIA-INTP)
-
Tags
/ Fusion Proteins
- 6xHis (N terminal on insert)
- TEV (N terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer CATCACCATCATCACCAC
- 3′ sequencing primer GATTATGCGGCCGTGTACAA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET-Duet1-6xHis-TEV-OPTN was a gift from Sascha Martens (Addgene plasmid # 190192 ; http://n2t.net/addgene:190192 ; RRID:Addgene_190192) -
For your References section:
p62 filaments capture and present ubiquitinated cargos for autophagy. Zaffagnini G, Savova A, Danieli A, Romanov J, Tremel S, Ebner M, Peterbauer T, Sztacho M, Trapannone R, Tarafder AK, Sachse C, Martens S. EMBO J. 2018 Mar 1;37(5). pii: embj.201798308. doi: 10.15252/embj.201798308. Epub 2018 Jan 17. 10.15252/embj.201798308 PubMed 29343546