pGES201
(Plasmid
#190197)
-
PurposeFor CRISPR-Cas9 mediated gene editing in soybean, soybean elongation factor 1A promoter (pM4)-Cas9, GmU6-sgRNA, Basta selection
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 190197 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCAMBIA1300
-
Backbone manufacturerCAMBIA
-
Vector typePlant Expression, CRISPR
-
Selectable markersBasta
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)ccdB Survival
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namespCas9
-
SpeciesS. pyogenes
-
Mutationplant-codon optimized
- Promoter Glycine max elongation factor 1A(pM4)
-
Tag
/ Fusion Protein
- 3xFlag (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (destroyed during cloning)
- 3′ cloning site BsaI (destroyed during cloning)
- 5′ sequencing primer GACAAGAAGTACAGCATCGG
- 3′ sequencing primer GTCGCCTCCCAGCTGAGACA
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This plasmid has an IS4 family transposase that exists in the original vector and does not affect function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGES201 was a gift from Yuefeng Guan (Addgene plasmid # 190197 ; http://n2t.net/addgene:190197 ; RRID:Addgene_190197) -
For your References section:
Generation of a multiplex mutagenesis population via pooled CRISPR-Cas9 in soya bean. Bai M, Yuan J, Kuang H, Gong P, Li S, Zhang Z, Liu B, Sun J, Yang M, Yang L, Wang D, Song S, Guan Y. Plant Biotechnol J. 2020 Mar;18(3):721-731. doi: 10.1111/pbi.13239. Epub 2019 Sep 9. 10.1111/pbi.13239 PubMed 31452351