Skip to main content

pGES201
(Plasmid #190197)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 190197 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCAMBIA1300
  • Backbone manufacturer
    CAMBIA
  • Vector type
    Plant Expression, CRISPR
  • Selectable markers
    Basta

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    ccdB Survival
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    spCas9
  • Species
    S. pyogenes
  • Mutation
    plant-codon optimized
  • Promoter Glycine max elongation factor 1A(pM4)
  • Tag / Fusion Protein
    • 3xFlag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsaI (destroyed during cloning)
  • 3′ cloning site BsaI (destroyed during cloning)
  • 5′ sequencing primer GACAAGAAGTACAGCATCGG
  • 3′ sequencing primer GTCGCCTCCCAGCTGAGACA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This plasmid has an IS4 family transposase that exists in the original vector and does not affect function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGES201 was a gift from Yuefeng Guan (Addgene plasmid # 190197 ; http://n2t.net/addgene:190197 ; RRID:Addgene_190197)
  • For your References section:

    Generation of a multiplex mutagenesis population via pooled CRISPR-Cas9 in soya bean. Bai M, Yuan J, Kuang H, Gong P, Li S, Zhang Z, Liu B, Sun J, Yang M, Yang L, Wang D, Song S, Guan Y. Plant Biotechnol J. 2020 Mar;18(3):721-731. doi: 10.1111/pbi.13239. Epub 2019 Sep 9. 10.1111/pbi.13239 PubMed 31452351