pGES401
(Plasmid
#190198)
-
PurposeFor CRISPR-Cas9 mediated multiple gene editing in soybean, single transcript unit system driven by soybean elongation factor 1A promoter (pM4), Basta selection
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 190198 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepCAMBIA1300
-
Backbone manufacturerCAMBIA
-
Vector typePlant Expression, CRISPR
-
Selectable markersBasta
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)ccdB Survival
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namespCas9
-
SpeciesS. pyogenes
-
Mutationplant-codon optimized
- Promoter Glycine max elongation factor 1A(pM4)
-
Tag
/ Fusion Protein
- 3xFlag (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (destroyed during cloning)
- 3′ cloning site BsaI (destroyed during cloning)
- 5′ sequencing primer GACAAGAAGTACAGCATCGG
- 3′ sequencing primer aaccttcctcttcttcttagg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGES401 was a gift from Yuefeng Guan (Addgene plasmid # 190198 ; http://n2t.net/addgene:190198 ; RRID:Addgene_190198) -
For your References section:
Combination of two multiplex genome-edited soybean varieties enables customization of protein functional properties. Bai M, Yuan C, Kuang H, Sun Q, Hu X, Cui L, Lin W, Peng C, Yue P, Song S, Guo Z, Guan Y. Mol Plant. 2022 Jul 4;15(7):1081-1083. doi: 10.1016/j.molp.2022.05.011. Epub 2022 May 27. 10.1016/j.molp.2022.05.011 PubMed 35643862