pZac2.1 gfaABC1D-LifeAct-GFP
(Plasmid
#190199)
-
PurposeExpresses the small actin binding peptide, LifeAct, with a GFP reporter
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 190199 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonePZac2.1
- Backbone size w/o insert (bp) 5103
- Total vector size (bp) 5973
-
Vector typeMammalian Expression, Bacterial Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLifeAct-eGFP
-
Alt nameLifeAct-GFP
-
SpeciesS. cerevisiae (budding yeast)
-
Insert Size (bp)870
- Promoter gfaABC1D
-
Tag
/ Fusion Protein
- GFP (C terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer ccactcccagttcaattacagc
- 3′ sequencing primer gtcttgtagttgccgtcgtc
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byAddgene plasmid 58470
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pZac2.1 gfaABC1D-LifeAct-GFP was a gift from Baljit Khakh (Addgene plasmid # 190199 ; http://n2t.net/addgene:190199 ; RRID:Addgene_190199) -
For your References section:
Astrocyte-neuron subproteomes and obsessive-compulsive disorder mechanisms. Soto JS, Jami-Alahmadi Y, Chacon J, Moye SL, Diaz-Castro B, Wohlschlegel JA, Khakh BS. Nature. 2023 Apr;616(7958):764-773. doi: 10.1038/s41586-023-05927-7. Epub 2023 Apr 12. 10.1038/s41586-023-05927-7 PubMed 37046092