Skip to main content
Addgene

FLAG-dCas13b-ADAR2DD
(Plasmid #190913)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 190913 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pC0055-CMV-dPspCas13b-GS-ADAR2DD(E488Q/T375G)-delta-984-1090
  • Backbone manufacturer
    Addgene
  • Backbone size w/o insert (bp) 9525
  • Total vector size (bp) 9646
  • Modifications to backbone
    Added 3x FLAG label
  • Vector type
    Mammalian Expression, CRISPR
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    3X FLAG
  • Species
    Synthetic
  • Insert Size (bp)
    211
  • Promoter CMV
  • Tag / Fusion Protein
    • 3X FLAG (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SacI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer gaggtctatataagcagagctctctgg
  • 3′ sequencing primer gtatcaaacttaagcttgccaccatgaac
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Addgene #114196

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    FLAG-dCas13b-ADAR2DD was a gift from Timothy Jarome (Addgene plasmid # 190913 ; http://n2t.net/addgene:190913 ; RRID:Addgene_190913)
  • For your References section:

    Proteasome-independent K63 polyubiquitination selectively regulates ATP levels and proteasome activity during fear memory formation in the female amygdala. Farrell K, Musaus M, Auerbach A, Navabpour S, Ray WK, Helm RF, Jarome TJ. Mol Psychiatry. 2023 May 17. doi: 10.1038/s41380-023-02112-0. 10.1038/s41380-023-02112-0 PubMed 37198264