Skip to main content

pLenti-EF1a-hMLH1dn-eGFP
(Plasmid #191104)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 191104 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pEGIP
  • Backbone manufacturer
    Linzhao Cheng
  • Backbone size w/o insert (bp) 8954
  • Total vector size (bp) 11279
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    hMLH1dn
  • Alt name
    Human MLH1 del754-756 with P2A
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    244144
  • Promoter EF-1a

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC
  • 3′ sequencing primer CGTCGCCGTCCAGCTCGACCAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti-EF1a-hMLH1dn-eGFP was a gift from Hyongbum Kim (Addgene plasmid # 191104 ; http://n2t.net/addgene:191104 ; RRID:Addgene_191104)
  • For your References section:

    Prediction of efficiencies for diverse prime editing systems in multiple cell types. Yu G, Kim HK, Park J, Kwak H, Cheong Y, Kim D, Kim J, Kim J, Kim HH. Cell. 2023 Apr 21:S0092-8674(23)00331-8. doi: 10.1016/j.cell.2023.03.034. 10.1016/j.cell.2023.03.034 PubMed 37119812