POLG-pcDNA3.1
              
              
                (Plasmid
                
                #191487)
              
            
            
            
          - 
            PurposeExpresses human POLG gene on pcDNA3.1 backbone. POLG gene is cloned with BamHI and XbaI restriction sites.
 - 
              Depositing Lab
 - 
          Publication
 - 
          Sequence Information
 
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 191487 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepcDNA3.1
 - 
              Backbone manufacturerAddgene
 - Backbone size w/o insert (bp) 5500
 - Total vector size (bp) 9173
 - 
              Vector typeMammalian Expression
 
Growth in Bacteria
- 
            Bacterial Resistance(s)Ampicillin, 100 μg/mL
 - 
            Growth Temperature37°C
 - 
            Growth Strain(s)DH5alpha
 - 
            Copy numberHigh Copy
 
Gene/Insert
- 
                Gene/Insert namePOLG
 - 
                    SpeciesH. sapiens (human)
 - 
                  Insert Size (bp)3720
 - 
                        Entrez GenePOLG (a.k.a. MDP1, MIRAS, MTDPS4A, MTDPS4B, PEO, POLG1, POLGA, SANDO, SCAE)
 - Promoter CMV, T7
 - 
    
        Tag
        / Fusion Protein
    
- V5 tag, 6X His (C terminal on insert)
 
 
Cloning Information
- Cloning method Restriction Enzyme
 - 5′ cloning site BamHI (not destroyed)
 - 3′ cloning site XbaI (not destroyed)
 - 5′ sequencing primer TAATACGACTCACTATAGGG
 - 3′ sequencing primer TCTAGATTCAATGGTCCAGGCTGGCTTCG (Common Sequencing Primers)
 
Terms and Licenses
- 
        Academic/Nonprofit Terms
 - 
      Industry Terms
- Not Available to Industry
 
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
 
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              
For your Materials & Methods section:
POLG-pcDNA3.1 was a gift from Hans Zempel (Addgene plasmid # 191487 ; http://n2t.net/addgene:191487 ; RRID:Addgene_191487)