pDMS151A_Tet-On-3G
(Plasmid
#191577)
-
PurposeClonTech-Takara's doxycycline-inducible, rtTA transactivator (Tet-On-3G) cloned into a 2nd generation lentiviral transfer plasmid (pGIPZ).
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 191577 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepGIPZ
-
Backbone manufacturerOpen Biosystems
- Total vector size (bp) 10533
-
Modifications to backboneC-terminus of insert: P2A self cleaving tag and BlastR gene.
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersHygromycin, Blasticidin ; HygroR is in plasmid backbone. BlastR is between LTRs and is packaged into lentivirus.
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTet-On(R) 3G
-
Alt namertTA
-
SpeciesSynthetic
-
Insert Size (bp)744
-
GenBank ID
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer cgcaaatgggcggtaggcgtg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDMS151A_Tet-On-3G was a gift from Joshua Leonard (Addgene plasmid # 191577 ; http://n2t.net/addgene:191577 ; RRID:Addgene_191577) -
For your References section:
Elucidating Design Principles for Engineering Cell-Derived Vesicles to Inhibit SARS-CoV-2 Infection. Gunnels TF, Stranford DM, Mitrut RE, Kamat NP, Leonard JN. Small. 2022 May;18(19):e2200125. doi: 10.1002/smll.202200125. Epub 2022 Apr 7. 10.1002/smll.202200125 PubMed 35388947