-
PurposeExpression of EGFP fused to core p300 histone acetyltransferase
-
Depositing Lab
-
Depositing OrganizationInstitut fuer Molekulare Biotechnologie (IMBA)
Located in Austria -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 191764 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepIRESpuro2
- Backbone size w/o insert (bp) 4831
- Total vector size (bp) 7738
-
Vector typeMammalian Expression, Bacterial Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameFRB-EGFP-p300 core
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2907
-
GenBank IDNM_001429
-
Entrez GeneEP300 (a.k.a. KAT3B, MKHK2, RSTS2, p300)
- Promoter EF1alpha
-
Tags
/ Fusion Proteins
- EGFP (N-terminal of p300 core) (N terminal on insert)
- FRB (N-terminal of EGFP) (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TAAGTGCAGTAGTCGCCGTGAACGT
- 3′ sequencing primer CATGCCCGCTTTTGAGA
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
EGFP-p300 was a gift from Daniel Gerlich (Addgene plasmid # 191764 ; http://n2t.net/addgene:191764 ; RRID:Addgene_191764) -
For your References section:
A mitotic chromatin phase transition prevents perforation by microtubules. Schneider MWG, Gibson BA, Otsuka S, Spicer MFD, Petrovic M, Blaukopf C, Langer CCH, Batty P, Nagaraju T, Doolittle LK, Rosen MK, Gerlich DW. Nature. 2022 Sep;609(7925):183-190. doi: 10.1038/s41586-022-05027-y. Epub 2022 Aug 3. 10.1038/s41586-022-05027-y PubMed 35922507