Skip to main content
Holiday Schedule: Addgene will be closed December 24 - December 31. Order processing and shipping will resume on January 3, 2022. For questions about estimated ship dates, please feel free to track your order status or contact [email protected].
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #19181)


Item Catalog # Description Quantity Price (USD)
Plasmid 19181 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 2050
  • Vector type
    Worm Expression

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Growth instructions
    EC100pir116 or other pir containing bacteria
  • Copy number
    Low Copy


  • Gene/Insert name
    Green fluorescent protein
  • Alt name
  • Species
    C. elegans (nematode)
  • Insert Size (bp)
  • Mutation
    S65C, contains synthetic introns for C. elegans
  • Tags / Fusion Proteins
    • FLAG (N terminal on insert)
    • daf-12 N-term 328 amino acids (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer GTCAGTGAGCGAGGAAGCGGAAG
  • 3′ sequencing primer ATTCAGGCTGCGCAACTGT
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMOD4 GFP was a gift from Al Fisher (Addgene plasmid # 19181 ; ; RRID:Addgene_19181)
  • For your References section:

    A simplified, robust, and streamlined procedure for the production of C. elegans transgenes via recombineering. Zhang Y, Nash L, Fisher AL.. BMC Dev Biol. 2008 Dec 30;8(1):119. 10.1186/1471-213X-8-119 PubMed 19116030