Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pMOD4 galK-G
(Plasmid #19182)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 19182 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pMOD4
  • Backbone manufacturer
    Epicentre
  • Backbone size w/o insert (bp) 2100
  • Vector type
    Recombineering

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    EC100pir116
  • Growth instructions
    EC100pir116 or other pir containing bacteria
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    galK
  • Species
    E.coli
  • Insert Size (bp)
    1381
  • Entrez Gene
    galK (a.k.a. b0757, ECK0746, galA)
  • Tags / Fusion Proteins
    • 50 nucleotides of FLAG-GFP (N terminal on insert)
    • 50 nucleotides of FLAG-GFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (not destroyed)
  • 3′ cloning site Acc65I (not destroyed)
  • 5′ sequencing primer GTCAGTGAGCGAGGAAGCGGAAG
  • 3′ sequencing primer ATTCAGGCTGCGCAACTGT
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    galK sequence is from pGalK (Warming and Copeland)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMOD4 galK-G was a gift from Al Fisher (Addgene plasmid # 19182 ; http://n2t.net/addgene:19182 ; RRID:Addgene_19182)
  • For your References section:

    A simplified, robust, and streamlined procedure for the production of C. elegans transgenes via recombineering. Zhang Y, Nash L, Fisher AL.. BMC Dev Biol. 2008 Dec 30;8(1):119. 10.1186/1471-213X-8-119 PubMed 19116030