ploxP unc-119
(Plasmid
#19185)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 19185 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepMOD4
-
Backbone manufacturerEpicentre
- Backbone size w/o insert (bp) 2100
-
Vector typeRecombineering
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)EC100pir116
-
Growth instructionsEC100pir116 or other pir containing bacteria
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameunc-119
-
SpeciesC. elegans (nematode)
-
Insert Size (bp)5733
-
Mutationcontains loxP site just 5' to ApaI site
-
Entrez Geneunc-119 (a.k.a. CELE_M142.1)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site ApaI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer GTCAGTGAGCGAGGAAGCGGAAG
- 3′ sequencing primer ATTCAGGCTGCGCAACTGT (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byunc-119 sequence is from pDP#MM016b
-
Terms and Licenses
-
Industry Terms
- Not Available to Industry
-
Article Citing this Plasmid
Depositor Comments
Few mismatches between Addgene and depositor sequence are in the 3' UTR and shouldn't have any impact on plasmid's function
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
ploxP unc-119 was a gift from Al Fisher (Addgene plasmid # 19185 ; http://n2t.net/addgene:19185 ; RRID:Addgene_19185) -
For your References section:
A simplified, robust, and streamlined procedure for the production of C. elegans transgenes via recombineering. Zhang Y, Nash L, Fisher AL.. BMC Dev Biol. 2008 Dec 30;8(1):119. 10.1186/1471-213X-8-119 PubMed 19116030