Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pUS252b
(Plasmid #191831)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 191831 Standard format: Plasmid sent in bacteria as agar stab 1 $85 *

* Login to view industry pricing.

Backbone

  • Vector backbone
    pK18
  • Backbone size w/o insert (bp) 2633
  • Total vector size (bp) 3356
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    fuGFPb
  • Species
    Synthetic
  • Insert Size (bp)
    726

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI, EcoRI, XbaI, XhoI (unknown if destroyed)
  • 3′ cloning site HindIII, PstI, SphI (unknown if destroyed)
  • 5′ sequencing primer CTTCCGGCTCGTATGTTGTG
  • 3′ sequencing primer GCAAGGCGATTAAGTTGGGTAACG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

fuGFPb is an open-source superfolding green fluorescent protein with excitation maximum at 485 nm and emission maximum at 510 nm. Relative to the original fuGFP, the protein contains the S65T and P211Q mutations, which increase its absorption of blue light (amino acid numbering based on classical GFP).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pUS252b was a gift from Nicholas Coleman (Addgene plasmid # 191831 ; http://n2t.net/addgene:191831 ; RRID:Addgene_191831)