pUS252L
(Plasmid
#191832)
-
PurposeExpresses fuBFP constitutively in E.coli cells. Designed to act as modular template for cutting out or amplifying fuBFP to place in other plasmid backbones
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 191832 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 * |
* Login to view industry pricing.
Backbone
-
Vector backbonepK18
- Backbone size w/o insert (bp) 2633
- Total vector size (bp) 3356
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namefuBFP
-
SpeciesSynthetic
-
Insert Size (bp)726
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI, EcoRI, XbaI, XhoI (unknown if destroyed)
- 3′ cloning site HindIII, PstI, SphI (unknown if destroyed)
- 5′ sequencing primer CTTCCGGCTCGTATGTTGTG
- 3′ sequencing primer GCAAGGCGATTAAGTTGGGTAACG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
fuBFP is an open-source superfolding blue fluorescent protein with excitation maximum at 376 nm and emission maximum at 447 nm. Relative to the original fuGFP, the protein contains the Y66H mutation (amino acid numbering based on classical GFP).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pUS252L was a gift from Nicholas Coleman (Addgene plasmid # 191832 ; http://n2t.net/addgene:191832 ; RRID:Addgene_191832)