Skip to main content

pLKO-Tet-ON-shCtrl (neo)
(Plasmid #192076)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 192076 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    Tet-pLKO-neo (Addgene #21916)
  • Backbone manufacturer
    Deposited by Dmitri Wiederschain
  • Backbone size w/o insert (bp) 9084
  • Total vector size (bp) 9142
  • Vector type
    Lentiviral
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    non-targeting randomized sequence
  • gRNA/shRNA sequence
    ATCTCGCTTGGGCGAGAGTAAG
  • Species
    Synthetic; non-targeting
  • Promoter H1 / Tet-responsive element

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (destroyed during cloning)
  • 3′ cloning site EcoRI (destroyed during cloning)
  • 5′ sequencing primer pLKO-sh-seq: ggcagggatattcaccattatcgtttcaga
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLKO-Tet-ON-shCtrl (neo) was a gift from Roland Friedel (Addgene plasmid # 192076 ; http://n2t.net/addgene:192076 ; RRID:Addgene_192076)