pLKO-Tet-ON-shCtrl (neo)
(Plasmid
#192076)
-
PurposeLentivirus for Dox-inducible expression of a non-targeting control shRNA
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 192076 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneTet-pLKO-neo (Addgene #21916)
-
Backbone manufacturerDeposited by Dmitri Wiederschain
- Backbone size w/o insert (bp) 9084
- Total vector size (bp) 9142
-
Vector typeLentiviral
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namenon-targeting randomized sequence
-
gRNA/shRNA sequenceATCTCGCTTGGGCGAGAGTAAG
-
SpeciesSynthetic; non-targeting
- Promoter H1 / Tet-responsive element
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (destroyed during cloning)
- 3′ cloning site EcoRI (destroyed during cloning)
- 5′ sequencing primer pLKO-sh-seq: ggcagggatattcaccattatcgtttcaga
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLKO-Tet-ON-shCtrl (neo) was a gift from Roland Friedel (Addgene plasmid # 192076 ; http://n2t.net/addgene:192076 ; RRID:Addgene_192076)