Skip to main content
Addgene

pHR-Traditional CAR (anti-CD19)
(Plasmid #192115)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 192115 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pHR
  • Backbone size w/o insert (bp) 8440
  • Total vector size (bp) 11310
  • Vector type
    Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    pHR-pEF1a-Traditional CAR (anti-CD19scFV_CD28_41BB_CD3z)
  • Species
    H. sapiens (human)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CAGTGCAGGGGAAAGAATAGTAGAC
  • 3′ sequencing primer CATAGCGTAAAAGGAGCAACA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHR-Traditional CAR (anti-CD19) was a gift from Wilson Wong (Addgene plasmid # 192115 ; http://n2t.net/addgene:192115 ; RRID:Addgene_192115)
  • For your References section:

    High-performance multiplex drug-gated CAR circuits. Li HS, Wong NM, Tague E, Ngo JT, Khalil AS, Wong WW. Cancer Cell. 2022 Aug 26. pii: S1535-6108(22)00372-5. doi: 10.1016/j.ccell.2022.08.008. 10.1016/j.ccell.2022.08.008 PubMed 36084652