pCRISPR-RFP entry
(Plasmid #192278)

• Purpose: Entry vector for cloning MmCas12m spacers. RFP flanked by MmCas12m CRISPR repeats can be digested out with BbsI.
• Depositing Lab: John van der Oost
• Publication: Wu et al Mol Cell. 2022 Dec 1;82(23):4487-4502.e7. doi: 10.1016/j.molcel.2022.11.003. Epub 2022 Nov 24.

Backbone

• Vector backbone: pBAD18
• Vector type: Bacterial Expression, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: RFP flanked by type V-M CRISPR repeat sequences
• Species: Synthetic
• Insert Size (bp): 1058
• Promoter: PJ23119

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ggtgatgtcggcgatatagg

Resource Information

• Supplemental Documents:
  • Copy of pCRISPR-Cas12m-RFP entry (seq_FAtTjxRM).gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Digestion with BbsI removes RFP and can be replaced with desired spacer sequence.