pCRISPR-RFP entry
(Plasmid
#192278)
-
PurposeEntry vector for cloning MmCas12m spacers. RFP flanked by MmCas12m CRISPR repeats can be digested out with BbsI.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 192278 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepBAD18
-
Vector typeBacterial Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameRFP flanked by type V-M CRISPR repeat sequences
-
SpeciesSynthetic
-
Insert Size (bp)1058
- Promoter PJ23119
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ggtgatgtcggcgatatagg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Digestion with BbsI removes RFP and can be replaced with desired spacer sequence.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCRISPR-RFP entry was a gift from John van der Oost (Addgene plasmid # 192278 ; http://n2t.net/addgene:192278 ; RRID:Addgene_192278) -
For your References section:
The miniature CRISPR-Cas12m effector binds DNA to block transcription. Wu WY, Mohanraju P, Liao C, Adiego-Perez B, Creutzburg SCA, Makarova KS, Keessen K, Lindeboom TA, Khan TS, Prinsen S, Joosten R, Yan WX, Migur A, Laffeber C, Scott DA, Lebbink JHG, Koonin EV, Beisel CL, van der Oost J. Mol Cell. 2022 Dec 1;82(23):4487-4502.e7. doi: 10.1016/j.molcel.2022.11.003. Epub 2022 Nov 24. 10.1016/j.molcel.2022.11.003 PubMed 36427491