Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pDEST_6xUAS:lyn-tagRFPt
(Plasmid #192354)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 192354 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    Gateway Tol2 destination vector with zebrafish aA-crystallin promoter driving CFP in lens
  • Total vector size (bp) 7207
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    lyn-tagRFPT
  • Tag / Fusion Protein
    • tagRFPT

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer gtctgaaacacaggccagat
  • 3′ sequencing primer CCACATTTGTAGAGGTTTTACTTGC
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Cloned by Jonas Hartmann from Darren Gilmours lab at UZH.

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDEST_6xUAS:lyn-tagRFPt was a gift from Darren Gilmour (Addgene plasmid # 192354 ; http://n2t.net/addgene:192354 ; RRID:Addgene_192354)
  • For your References section:

    A role for the centrosome in regulating the rate of neuronal efferocytosis by microglia in vivo. Moller K, Brambach M, Villani A, Gallo E, Gilmour D, Peri F. Elife. 2022 Nov 18;11:e82094. doi: 10.7554/eLife.82094. 10.7554/eLife.82094 PubMed 36398880