Skip to main content

pLentiCRISPRv2-sgLmnb2-HepmCherry
(Plasmid #192830)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 192830 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLentiCRISPRv2-Stuffer-HepmCherry
  • Backbone manufacturer
    Knouse Lab
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mCherry
  • gRNA/shRNA sequence
    AGGTACGGGAGACCCGACGG
  • Species
    M. musculus (mouse)
  • Promoter U6 for sgRNA and hepatocyte-specific promoter (HS-CRM8-TTRmin module from Chuah et al. Molecular Therapy 2014) for mCherry

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLentiCRISPRv2-sgLmnb2-HepmCherry was a gift from Kristin Knouse (Addgene plasmid # 192830 ; http://n2t.net/addgene:192830 ; RRID:Addgene_192830)
  • For your References section:

    Genome-scale CRISPR screening in a single mouse liver. Keys HR, Knouse KA. Cell Genom. 2022 Dec 14;2(12):100217. doi: 10.1016/j.xgen.2022.100217. Epub 2022 Nov 15. 10.1016/j.xgen.2022.100217 PubMed 36643909