pJLG029
(Plasmid
#192980)
-
PurposeBHR plasmid (pRA301) expressing pruR-3XFLAG from T7 promoter for high yield protein purification
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 192980 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepRA301
- Backbone size w/o insert (bp) 6761
- Total vector size (bp) 7840
-
Modifications to backboneBases 1410 to 905 amplified from pMAT36 (pRA301::PT7-mirA-3XFLAG) a pRA301 derivative
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namepruR-3xFLAG
-
SpeciesA. tumefaciens
-
Insert Size (bp)606
-
GenBank IDNC_003062.2
- Promoter T7
-
Tag
/ Fusion Protein
- 3XFLAG (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
PruR is a periplasmic protein from Agrobacterium tumefaciens and can be used in conjunction with pJLG038 or pJLG039, which carry an inducible T7 polymerase. It can be replaced with a gene of interest for high yield protein expression from a native host.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJLG029 was a gift from Clay Fuqua (Addgene plasmid # 192980 ; http://n2t.net/addgene:192980 ; RRID:Addgene_192980) -
For your References section:
An Inducible T7 Polymerase System for High-Level Protein Expression in Diverse Gram-Negative Bacteria. Greenwich JL, Alakavuklar MA, Fuqua C. Microbiol Resour Announc. 2023 Feb 16;12(2):e0111922. doi: 10.1128/mra.01119-22. Epub 2023 Jan 16. 10.1128/mra.01119-22 PubMed 36645284