pJLG039
(Plasmid
#192982)
-
PurposeBHR plasmid (IncP ori) expressing T7 polymerase under control of the lac promoter
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 192982 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSW213
- Backbone size w/o insert (bp) 8751
- Total vector size (bp) 11370
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Tetracycline, 10 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameT7 polymerase
-
SpeciesE. coli
-
Insert Size (bp)2652
-
GenBank IDNC_012971
- Promoter lac
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site KpnI (not destroyed)
- 5′ sequencing primer TCACACAGGAAACAGCTATGAC
- 3′ sequencing primer CGCCAGGGTTTTCCCAGTCACGAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The T7 polymerase gene (1) was cloned from the chromosome of BL21(DE3).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJLG039 was a gift from Clay Fuqua (Addgene plasmid # 192982 ; http://n2t.net/addgene:192982 ; RRID:Addgene_192982) -
For your References section:
An Inducible T7 Polymerase System for High-Level Protein Expression in Diverse Gram-Negative Bacteria. Greenwich JL, Alakavuklar MA, Fuqua C. Microbiol Resour Announc. 2023 Feb 16;12(2):e0111922. doi: 10.1128/mra.01119-22. Epub 2023 Jan 16. 10.1128/mra.01119-22 PubMed 36645284