Skip to main content

pCW-tTRE-scFv-SunTag
(Plasmid #193138)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 193138 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCW-tTRE
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    scFv-SunTag
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1998
  • Promoter tight TRE promoter

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHi (destroyed during cloning)
  • 3′ cloning site BamHi (destroyed during cloning)
  • 5′ sequencing primer AGCTCGTTTAGTGAACCGTCAGATC
  • 3′ sequencing primer GACCCAGGGTCGGCGCCGCTG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCW-tTRE-scFv-SunTag was a gift from Brad Rosenberg (Addgene plasmid # 193138 ; http://n2t.net/addgene:193138 ; RRID:Addgene_193138)
  • For your References section:

    Inducible CRISPR activation screen for interferon-stimulated genes identifies OAS1 as a SARS-CoV-2 restriction factor. Danziger O, Patel RS, DeGrace EJ, Rosen MR, Rosenberg BR. PLoS Pathog. 2022 Apr 14;18(4):e1010464. doi: 10.1371/journal.ppat.1010464. eCollection 2022 Apr. 10.1371/journal.ppat.1010464 PubMed 35421191