Skip to main content

pJBL3907
(Plasmid #193140)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 193140 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    p15A
  • Backbone size w/o insert (bp) 2200
  • Total vector size (bp) 1000
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Clostridium beijerinckii (Cbe) pfl ZTP riboswitch with sfGFP
  • Insert Size (bp)
    1000
  • Promoter J23119

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer tcgataagcttccgatggcg
  • 3′ sequencing primer GTTTTCCGTATGTTGCATCACC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJBL3907 was a gift from Julius Lucks (Addgene plasmid # 193140 ; http://n2t.net/addgene:193140 ; RRID:Addgene_193140)
  • For your References section:

    Tuning strand displacement kinetics enables programmable ZTP riboswitch dynamic range in vivo. Bushhouse DZ, Lucks JB. Nucleic Acids Res. 2023 Mar 2:gkad110. doi: 10.1093/nar/gkad110. 10.1093/nar/gkad110 PubMed 36864761