pJBL6090
(Plasmid
#193142)
-
PurposeClostridium beijerinckii pfl ZTP riboswitch A26∆ OFF control with sfGFP reporter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 193142 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonep15A
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameCbe ZTP Riboswitch sfGFP
-
SpeciesClostridium beijerinckii
-
Insert Size (bp)1000
-
MutationDeleted A26 to disable ligand-binding
- Promoter J23119
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer tcgataagcttccgatggcg
- 3′ sequencing primer GTTTTCCGTATGTTGCATCACC (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJBL6090 was a gift from Julius Lucks (Addgene plasmid # 193142 ; http://n2t.net/addgene:193142 ; RRID:Addgene_193142) -
For your References section:
Tuning strand displacement kinetics enables programmable ZTP riboswitch dynamic range in vivo. Bushhouse DZ, Lucks JB. Nucleic Acids Res. 2023 Mar 2:gkad110. doi: 10.1093/nar/gkad110. 10.1093/nar/gkad110 PubMed 36864761