Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Lenti-sgTnr#2/Cre
(Plasmid #193245)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 193245 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pLL3.3
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sgTnr#2
  • gRNA/shRNA sequence
    CCTGGGAAGAGCTTGCACAT
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    20
  • Entrez Gene
    Tnr (a.k.a. J1-ten, J1-tenascin, TN, TN-R, ja, janusin, rest, restrictin)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)
  • 3′ cloning site Unknown (unknown if destroyed)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Lenti-sgTnr#2/Cre was a gift from Julien Sage (Addgene plasmid # 193245 ; http://n2t.net/addgene:193245 ; RRID:Addgene_193245)
  • For your References section:

    A multiplexed in vivo approach to identify driver genes in small cell lung cancer. Lee MC, Cai H, Murray CW, Li C, Shue YT, Andrejka L, He AL, Holzem AME, Drainas AP, Ko JH, Coles GL, Kong C, Zhu S, Zhu C, Wang J, van de Rijn M, Petrov DA, Winslow MM, Sage J. Cell Rep. 2023 Jan 13;42(1):111990. doi: 10.1016/j.celrep.2023.111990. 10.1016/j.celrep.2023.111990 PubMed 36640300