Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pELPS-eDHFR-YFP-T2A-Renilla
(Plasmid #193253)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 193253 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pELPS
  • Backbone size w/o insert (bp) 6770
  • Total vector size (bp) 8975
  • Modifications to backbone
    BamHI and SalI for inserts.
  • Vector type
    Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    LB or TB for growth
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    The eDHFR (PET reporter gene) fused to yellow fluorescent protein (YFP) and a T2A cleavage site followed by Renilla luciferase
  • Alt name
    eDHFR-YFP-T2A-Renilla
  • Species
    the Escherichia coli
  • Insert Size (bp)
    2205
  • Mutation
    None
  • GenBank ID
    WP_000624375.1
  • Promoter EF1a
  • Tags / Fusion Proteins
    • yellow fluorescent protein (YFP) (C terminal on insert)
    • Renilla luciferase (rLuc) (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer CTTGGTTCATTCTCAAGCCTCAGAC
  • 3′ sequencing primer GCAATAGCATGATACAAAGGCATTAAAG
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pELPS-eDHFR-YFP-T2A-Renilla was a gift from Mark Sellmyer (Addgene plasmid # 193253 ; http://n2t.net/addgene:193253 ; RRID:Addgene_193253)
  • For your References section:

    Imaging CAR T Cell Trafficking with eDHFR as a PET Reporter Gene. Sellmyer MA, Richman SA, Lohith K, Hou C, Weng CC, Mach RH, O'Connor RS, Milone MC, Farwell MD. Mol Ther. 2020 Jan 8;28(1):42-51. doi: 10.1016/j.ymthe.2019.10.007. Epub 2019 Oct 15. 10.1016/j.ymthe.2019.10.007 PubMed 31668558