Skip to main content
Addgene

T7-VEE-CFP-e2a-SOX2-p2a-KLF4
(Plasmid #193358)

Ordering

This material is available to academics and nonprofits only. Orders shipped outside the U.S. may require additional regulatory approval, as well as a non-refundable export license fee of $85. Please log in to view availability.
Item Catalog # Description Quantity Price (USD)
Plasmid 193358 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    T7-VEE-IRES-puro (Addgene plasmid 58970)
  • Total vector size (bp) 14038
  • Vector type
    Mammalian Expression ; Venezuelan equine encephalitis (VEE) virus RNA replicon
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    CFP-e2a-SOX2-p2a-KLF4
  • Alt name
    Cyan Fluorescent Protein
  • Alt name
    SOX2
  • Alt name
    KLF4
  • Species
    H. sapiens (human); Aequorea victoria
  • Insert Size (bp)
    3267
  • Entrez Gene
    KLF4 (a.k.a. EZF, GKLF)
  • Entrez Gene
    SOX2 (a.k.a. ANOP3, MCOPS3)
  • Promoter T7

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site ClaI (not destroyed)
  • 3′ cloning site ClaI (not destroyed)
  • 5′ sequencing primer CGGCTAACCTGAATGGACTACGAC
  • 3′ sequencing primer TATAGACAAACGCACACCG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    T7-VEE-CFP-e2a-SOX2-p2a-KLF4 was a gift from Hans Schöler (Addgene plasmid # 193358 ; http://n2t.net/addgene:193358 ; RRID:Addgene_193358)
  • For your References section:

    Highly cooperative chimeric super-SOX induces naive pluripotency across species. MacCarthy CM, Wu G, Malik V, Menuchin-Lasowski Y, Velychko T, Keshet G, Fan R, Bedzhov I, Church GM, Jauch R, Cojocaru V, Scholer HR, Velychko S. Cell Stem Cell. 2024 Jan 4;31(1):127-147.e9. doi: 10.1016/j.stem.2023.11.010. Epub 2023 Dec 22. 10.1016/j.stem.2023.11.010 PubMed 38141611