T7-VEE-CFP-e2a-SOX2-17-p2a-KLF4
(Plasmid
#193360)
-
PurposeVEE-CFP-S*K (self-replicating RNA vector expressing CFP + human super-SOX + KLF4 + PuroR) for integration-free naïve conversion
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 193360 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneT7-VEE-IRES-puro (Addgene plasmid 58970)
- Total vector size (bp) 14248
-
Vector typeMammalian Expression ; Venezuelan equine encephalitis (VEE) virus RNA replicon
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameCFP-e2a-SOX2-17-p2a-KLF4
-
Alt nameCyan Fluorescent Protein
-
Alt nameS*
-
Alt namesuperSOX
-
SpeciesH. sapiens (human); Aequorea victoria
-
Insert Size (bp)3477
-
MutationSOX2-17 is engineered highly cooperative chimeric transcription factor, where the following elements of SOX2 were swapped with SOX17: 43-47, 61, 65-86 and CTD
-
Entrez GeneKLF4 (a.k.a. EZF, GKLF)
-
Entrez GeneSOX2 (a.k.a. ANOP3, MCOPS3)
- Promoter T7
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site ClaI (not destroyed)
- 3′ cloning site ClaI (not destroyed)
- 5′ sequencing primer CGGCTAACCTGAATGGACTACGAC
- 3′ sequencing primer TATAGACAAACGCACACCG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2022.09.23.509242v1 for BioRxiv preprint
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
T7-VEE-CFP-e2a-SOX2-17-p2a-KLF4 was a gift from Hans Schöler (Addgene plasmid # 193360 ; http://n2t.net/addgene:193360 ; RRID:Addgene_193360) -
For your References section:
Highly cooperative chimeric super-SOX induces naive pluripotency across species. MacCarthy CM, Wu G, Malik V, Menuchin-Lasowski Y, Velychko T, Keshet G, Fan R, Bedzhov I, Church GM, Jauch R, Cojocaru V, Scholer HR, Velychko S. Cell Stem Cell. 2024 Jan 4;31(1):127-147.e9. doi: 10.1016/j.stem.2023.11.010. Epub 2023 Dec 22. 10.1016/j.stem.2023.11.010 PubMed 38141611