Skip to main content
Addgene

pLKO-Tet-On shYap1-1
(Plasmid #193669)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 193669 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLKO-Tet-On
  • Vector type
    Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Yap1
  • gRNA/shRNA sequence
    GAAGCGCTGAGTTCCGAAATC
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Yap1 (a.k.a. Yap, Yap65, Yki, Yorkie)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Age1 (unknown if destroyed)
  • 3′ cloning site EcoR1 (unknown if destroyed)
  • 5′ sequencing primer ggcagggatattcaccattatcgtttcaga
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLKO-Tet-On shYap1-1 was a gift from William Hahn (Addgene plasmid # 193669 ; http://n2t.net/addgene:193669 ; RRID:Addgene_193669)
  • For your References section:

    YAP1 and PRDM14 converge to promote cell survival and tumorigenesis. Kim M, Ly SH, Xie Y, Duronio GN, Ford-Roshon D, Hwang JH, Sulahian R, Rennhack JP, So J, Gjoerup O, Talamas JA, Grandclaudon M, Long HW, Doench JG, Sethi NS, Giannakis M, Hahn WC. Dev Cell. 2022 Jan 24;57(2):212-227.e8. doi: 10.1016/j.devcel.2021.12.006. Epub 2022 Jan 5. 10.1016/j.devcel.2021.12.006 PubMed 34990589