Skip to main content

pLentiCas9-T2A-mApple
(Plasmid #193780)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 193780 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLentiCas9-T2A-GFP
  • Backbone manufacturer
    Addgene #78548
  • Backbone size w/o insert (bp) 13014
  • Total vector size (bp) 13669
  • Modifications to backbone
    Replace EGFP with mApple
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mApple
  • Species
    Synthetic
  • Insert Size (bp)
    686
  • Promoter In frame with Cas9

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer gggcgaggagaataacatggccatcatcaaggagttcatg
  • 3′ sequencing primer cgtccatgccgccggtggagtggcggccctcggcgcgttc
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    mApple-N1 (Addgene #54567)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2023.04.03.535384 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLentiCas9-T2A-mApple was a gift from James Eshleman (Addgene plasmid # 193780 ; http://n2t.net/addgene:193780 ; RRID:Addgene_193780)
  • For your References section:

    CRISPR-Cas9 for selective targeting of somatic mutations in pancreatic cancers. Teh SSK, Bowland K, Halper-Stromberg E, Kotwal A, Bennett A, Skaist A, Tang J, Cai F, Macoretta A, Liang H, Kamiyama H, Wheelan S, Lin MT, Hruban RH, Hung CF, Goldstein M, Scharpf RB, Roberts NJ, Eshleman JR. NAR Cancer. 2024 Jun 19;6(2):zcae028. doi: 10.1093/narcan/zcae028. eCollection 2024 Jun. 10.1093/narcan/zcae028 PubMed 38915758