pMS84 (U6p::GGACAGTCCTGCCGAGGTGG) Sequences (1)
Addgene-Verified Full Sequences (1)
Full sequence data is generally produced from one of three sources and is indicated in the sequence header:
- Addgene NGS Result: generated by next-generation sequencing at Addgene
- Plasmidsaurus Whole Plasmid Sequence: generated by Whole Plasmid Sequencing at Plasmidsaurus
- Assembled Sequence: built from reference sequence(s) and/or Sanger reads
Addgene scientists verify that the plasmid sequence matches expected annotations and/or depositor-provided sequences. Learn about Addgene's QC standards.