Skip to main content

pMS84 (U6p::GGACAGTCCTGCCGAGGTGG) Sequences (1)


Addgene-Verified Sequences:

Addgene-Verified Full Sequences (1)

Full sequence data is generally produced from one of three sources and is indicated in the sequence header:

  • Addgene NGS Result: generated by next-generation sequencing at Addgene
  • Plasmidsaurus Whole Plasmid Sequence: generated by Whole Plasmid Sequencing at Plasmidsaurus
  • Assembled Sequence: built from reference sequence(s) and/or Sanger reads

Addgene scientists verify that the plasmid sequence matches expected annotations and/or depositor-provided sequences. Learn about Addgene's QC standards.