Skip to main content

pDSP15 (5’Δ HygR + loxP + MCS + 5’Δ mScarlet-I)
(Plasmid #193853)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 193853 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pDSP1
  • Total vector size (bp) 4168
  • Vector type
    Worm Expression, Cre/Lox, CRISPR
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    5' rps-0::HygR + 5' mScarlet-I
  • Species
    Synthetic
  • Insert Size (bp)
    2098
  • Promoter rps-0p

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CGTTGAATACTCAGTCAACG
  • 3′ sequencing primer TAGATCCTTCCATGTGAACC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDSP15 (5’Δ HygR + loxP + MCS + 5’Δ mScarlet-I) was a gift from Patrick Phillips (Addgene plasmid # 193853 ; http://n2t.net/addgene:193853 ; RRID:Addgene_193853)
  • For your References section:

    High-throughput library transgenesis in Caenorhabditis elegans via Transgenic Arrays Resulting in Diversity of Integrated Sequences (TARDIS). Stevenson ZC, Moerdyk-Schauwecker MJ, Banse SA, Patel DS, Lu H, Phillips PC. Elife. 2023 Jul 4;12:RP84831. doi: 10.7554/eLife.84831. 10.7554/eLife.84831 PubMed 37401921