Sth1Cas9n cytosine base editor
(Plasmid
#194209)
-
PurposeSth1Cas9-D9A-nickase_rAPOBEC1_cytosine base editor for RNA recording
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 194209 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCBS1489
- Backbone size w/o insert (bp) 6495
- Total vector size (bp) 9855
-
Modifications to backboneInsert Sth1Cas9-D9A nickase
-
Vector typeBacterial Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)MDS™42 Meta LowMut (C-6786-10K, Scarab Genomics, LLC.)
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameSth1Cas9-D9A nickase
-
SpeciesStreptococcus thermophilus
-
Insert Size (bp)3360
-
MutationChanged Aspartate 9 to Alanine.
-
GenBank IDCP000419.1
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer cagaaatgtcctgagcaatcac
- 3′ sequencing primer catgcaactcgtaggacaggtg
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Sth1Cas9n cytosine base editor was a gift from Chase Beisel (Addgene plasmid # 194209 ; http://n2t.net/addgene:194209 ; RRID:Addgene_194209) -
For your References section:
RNA recording in single bacterial cells using reprogrammed tracrRNAs. Jiao C, Reckstadt C, Konig F, Homberger C, Yu J, Vogel J, Westermann AJ, Sharma CM, Beisel CL. Nat Biotechnol. 2023 Jan 5. doi: 10.1038/s41587-022-01604-8. 10.1038/s41587-022-01604-8 PubMed 36604543