CJ8421_04975 Rptr2 recording plasmid
(Plasmid
#194211)
-
PurposeCJ8421_04975 Rptr2 targeted DNA sequence
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 194211 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonesc101-KanR-P70a-deGFP
- Backbone size w/o insert (bp) 4863
- Total vector size (bp) 4890
-
Modifications to backboneInserting 27bp PAM-flanking DNA target (taagttcaatgtttttacattgAGAAA) in front of OR2-OR1 promoter in the backbone vector.
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)One Shot™ TOP10
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameCJ8421_04975 Rptr2 DNA target
-
Insert Size (bp)27
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer TGGGTGGGCTAACGATATCC
- 3′ sequencing primer GAACTTCAGGGTCAGCTTGC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CJ8421_04975 Rptr2 recording plasmid was a gift from Chase Beisel (Addgene plasmid # 194211 ; http://n2t.net/addgene:194211 ; RRID:Addgene_194211) -
For your References section:
RNA recording in single bacterial cells using reprogrammed tracrRNAs. Jiao C, Reckstadt C, Konig F, Homberger C, Yu J, Vogel J, Westermann AJ, Sharma CM, Beisel CL. Nat Biotechnol. 2023 Jan 5. doi: 10.1038/s41587-022-01604-8. 10.1038/s41587-022-01604-8 PubMed 36604543