Skip to main content

pLV hU6-gRNA hUbC-dSaCas9-KRAB-T2A-Thy1.1
(Plasmid #194278)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 194278 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    FUGW
  • Backbone size w/o insert (bp) 9579
  • Total vector size (bp) 13728
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    humanized dSaCas9 KRAB T2A Thy1.1
  • Insert Size (bp)
    4149
  • Promoter hUbC
  • Tag / Fusion Protein
    • HA

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer gaaatgtaatcatttgggtc
  • 3′ sequencing primer ATGAAAGCCATACGGGAAGC
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    gRNA
  • Promoter hU6

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site Esp3I (destroyed during cloning)
  • 3′ cloning site Esp3I (destroyed during cloning)
  • 5′ sequencing primer GACTATCATATGCTTACCGT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2023.05.01.538906 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLV hU6-gRNA hUbC-dSaCas9-KRAB-T2A-Thy1.1 was a gift from Charles Gersbach (Addgene plasmid # 194278 ; http://n2t.net/addgene:194278 ; RRID:Addgene_194278)
  • For your References section:

    Orthogonal CRISPR screens to identify transcriptional and epigenetic regulators of human CD8 T cell function. McCutcheon SR, Swartz AM, Brown MC, Barrera A, McRoberts Amador C, Siklenka K, Humayun L, Isaacs JM, Reddy TE, Nair S, Antonia S, Gersbach CA. bioRxiv. 2023 May 1:2023.05.01.538906. doi: 10.1101/2023.05.01.538906. Preprint. 10.1101/2023.05.01.538906 PubMed 37205457