pLV hU6-gRNA hUbC-VP64-dSaCas9-VP64-T2A-Thy1.1
(Plasmid
#194279)
-
PurposeExpresses gRNA and VP64-dSaCas9-VP64 from lentiviral vector
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 194279 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneFUGW
- Backbone size w/o insert (bp) 9579
- Total vector size (bp) 13812
-
Vector typeMammalian Expression, Lentiviral, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert namehumanized VP64 dSaCas9 VP64 T2A Thy1.1
-
Insert Size (bp)4233
- Promoter hUbC
-
Tag
/ Fusion Protein
- HA
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer gaaatgtaatcatttgggtc
- 3′ sequencing primer ATGAAAGCCATACGGGAAGC (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namegRNA
- Promoter hU6
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site Esp3I (destroyed during cloning)
- 3′ cloning site Esp3I (destroyed during cloning)
- 5′ sequencing primer GACTATCATATGCTTACCGT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2023.05.01.538906 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLV hU6-gRNA hUbC-VP64-dSaCas9-VP64-T2A-Thy1.1 was a gift from Charles Gersbach (Addgene plasmid # 194279 ; http://n2t.net/addgene:194279 ; RRID:Addgene_194279) -
For your References section:
Orthogonal CRISPR screens to identify transcriptional and epigenetic regulators of human CD8 T cell function. McCutcheon SR, Swartz AM, Brown MC, Barrera A, McRoberts Amador C, Siklenka K, Humayun L, Isaacs JM, Reddy TE, Nair S, Antonia S, Gersbach CA. bioRxiv. 2023 May 1:2023.05.01.538906. doi: 10.1101/2023.05.01.538906. Preprint. 10.1101/2023.05.01.538906 PubMed 37205457