Skip to main content

pGL4_10xUAS-MLPmin-luc2
(Plasmid #194383)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 194383 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 194383-D50 50 μg of DNA in Tris buffer $495
DNA 194383-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pGL4
  • Vector type
    Mammalian Expression
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    10xUAS-luc2
  • Species
    Synthetic
  • Promoter MLP minimal

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglI (not destroyed)
  • 3′ cloning site NheI (not destroyed)
  • 5′ sequencing primer CTAGCAAAATAGGCTGTCCC
  • 3′ sequencing primer GAAATTTGTGATGCTATTGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGL4_10xUAS-MLPmin-luc2 was a gift from Michael Wehr (Addgene plasmid # 194383 ; http://n2t.net/addgene:194383 ; RRID:Addgene_194383)
  • For your References section:

    Improved Split TEV GPCR beta-arrestin-2 Recruitment Assays via Systematic Analysis of Signal Peptide and beta-arrestin Binding Motif Variants. Wu Y, von Hauff IV, Jensen N, Rossner MJ, Wehr MC. Biosensors (Basel). 2022 Dec 29;13(1):48. doi: 10.3390/bios13010048. 10.3390/bios13010048 PubMed 36671883