pSDM177
(Plasmid
#194476)
-
PurposepHERD30T-crRNA(Lse)_V3
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 194476 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepHERD30T
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Gentamicin, 10 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namecrRNA(Lse)
-
gRNA/shRNA sequencectcggtacccggggatcctc
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSDM177 was a gift from Joseph Bondy-Denomy (Addgene plasmid # 194476 ; http://n2t.net/addgene:194476 ; RRID:Addgene_194476) -
For your References section:
Bacteriophage genome engineering with CRISPR-Cas13a. Guan J, Oromi-Bosch A, Mendoza SD, Karambelkar S, Berry JD, Bondy-Denomy J. Nat Microbiol. 2022 Oct 31. pii: 10.1038/s41564-022-01243-4. doi: 10.1038/s41564-022-01243-4. 10.1038/s41564-022-01243-4 PubMed 36316452