Skip to main content

pX458-AAVS1-sg
(Plasmid #194721)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 194721 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCDNA3.6
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Cas9
  • gRNA/shRNA sequence
    ggggccactagggacaggat
  • Species
    Streptococcus pyogenes
  • Entrez Gene
    AAVS1 (a.k.a. AAV)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)
  • 3′ cloning site unknown (unknown if destroyed)
  • 5′ sequencing primer unknown
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pX458-AAVS1-sg was a gift from Rudolf Jaenisch (Addgene plasmid # 194721 ; http://n2t.net/addgene:194721 ; RRID:Addgene_194721)
  • For your References section:

    Multiplex Genome Editing of Human Pluripotent Stem Cells Using Cpf1. Ma H. Bio Protoc. 2024 Nov 20;14(22):e5108. doi: 10.21769/BioProtoc.5108. eCollection 2024 Nov 20. 10.21769/BioProtoc.5108 PubMed 39600977