pX458-AAVS1-sg
(Plasmid
#194721)
-
Purposepx458 with guide RNA that target hAAVS1
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 194721 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepCDNA3.6
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCas9
-
gRNA/shRNA sequenceggggccactagggacaggat
-
SpeciesStreptococcus pyogenes
-
Entrez GeneAAVS1 (a.k.a. AAV)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
- 3′ cloning site unknown (unknown if destroyed)
- 5′ sequencing primer unknown (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
p-8 of Supplemental Table 2 of https://www.biorxiv.org/content/10.1101/2022.04.13.488123v1.full
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pX458-AAVS1-sg was a gift from Rudolf Jaenisch (Addgene plasmid # 194721 ; http://n2t.net/addgene:194721 ; RRID:Addgene_194721) -
For your References section:
Multiplex genome editing of human pluripotent stem cells using Cpf1. Haiting Ma, Rudolf Jaenisch. bioRxiv 10.1101/2022.04.13.488123